View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12068_high_5 (Length: 302)
Name: NF12068_high_5
Description: NF12068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12068_high_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 16 - 154
Target Start/End: Complemental strand, 12080452 - 12080314
Alignment:
| Q |
16 |
aaaagggcaaaaggggttgtgctaaaagcttcttctggtgcattgaatgtgaattcaaagcaaagtgtttcagttgaaaaatccaaatccaatgatccaa |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
12080452 |
aaaagggcaaaaggggttgtgctaaaagcttcttctggtgcattgaatgtgaattcaaagcaaggtgtttcagttgaaaaatccaaatccaatgatccaa |
12080353 |
T |
|
| Q |
116 |
ttgttgttattgataactatgatagctttacctataatc |
154 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12080352 |
ttgttgttattgataactatgatagctttacctataatc |
12080314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 229 - 296
Target Start/End: Complemental strand, 12080239 - 12080172
Alignment:
| Q |
229 |
atggttaatggatttgtattgaaactaataattaagcttgatgattgatgaatgttatatatgattga |
296 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12080239 |
atggttaatggatttgtattgaaaataataattaagcttgatgattgatgaatgttatatatgattga |
12080172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University