View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12068_high_6 (Length: 290)
Name: NF12068_high_6
Description: NF12068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12068_high_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 147 - 278
Target Start/End: Original strand, 9695254 - 9695385
Alignment:
| Q |
147 |
ctgaaataatcgatatcatgaataaaaactatatttttagtaattttaataggttttgagaatttaggggggtaattacttgtgggtttagtttaattat |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
9695254 |
ctgaaataatcgatatcatgaataaaaactatatttttagtaattttaataggttttgagaatttagggggttaattacttgtgggtttagtttaattat |
9695353 |
T |
 |
| Q |
247 |
caactgccactaactgtatgtttggttctgtg |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
9695354 |
caactgccactaactgtatgtttggttctgtg |
9695385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 18 - 110
Target Start/End: Original strand, 9695126 - 9695218
Alignment:
| Q |
18 |
cttctcatggtgatcttgctgctgctgctgaaaattctatctgggtttttaaccatggttctgttaagtctaaaggtaacttaaagtttcgac |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9695126 |
cttctcatggtgatcttgctgctgctgctgaaaattctatctgggtttttaaccatggttctgttaagtctaaaggtaacttaaagtttcgac |
9695218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University