View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12068_low_4 (Length: 398)
Name: NF12068_low_4
Description: NF12068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12068_low_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 100 - 369
Target Start/End: Complemental strand, 29513402 - 29513133
Alignment:
| Q |
100 |
cattggagttactcgaacagtacatcctaaacttcatgttgtttcaggtggagtgagattcgacgggtcattacctttaaacgacgacgacgaagttgtt |
199 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||||| ||||||||||| ||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29513402 |
cattggagttactcgaacagtacttcccaaacttcacgttgtttcaggaggagtgagatttgacgggtcattacctctaaacgacgacgacgaagttgtt |
29513303 |
T |
 |
| Q |
200 |
ttcgagcactgcgttacgcggactctgcctcccgcgcttacattggaagacggacttcacaaattgaaagacgctcttgagattttgaagctttctccgc |
299 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||| |||||| |
|
|
| T |
29513302 |
ttcgagcactgcgttacacggactctgcctcccgcgcttacattggaagacggacttcacaaattgaaagatgctcttgagattttgaaacttgctccgc |
29513203 |
T |
 |
| Q |
300 |
ctagttgtgacactgggttccttaggtttcaggtatctcaatgtctaaccgtagttctatcttcttcttc |
369 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
29513202 |
ctagttgtgagactggattccttaggtttcaggtatctcaatgtctaaccatagttctatcttcttcttc |
29513133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University