View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12069_low_1 (Length: 435)
Name: NF12069_low_1
Description: NF12069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12069_low_1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 12 - 228
Target Start/End: Original strand, 52852975 - 52853194
Alignment:
| Q |
12 |
caaaggaggaaaaggaagaaattggactcaacggattcgggctttccgatgatttttgcaacaactttggtggcatccctgagaatgtcggaagcaataa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52852975 |
caaaggaggaaaaggaagaaattggactcaacggattcgggctttccgatgatttttgcaacaactttggtggcatccctgagaatgtcggaagcaataa |
52853074 |
T |
|
| Q |
112 |
caggatccacggggatgttggtgaagaggttcaaagtgggcattgcgttgtccttgagtccttcaggataaggta---ggtgtttttcccttcacacacc |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
52853075 |
caggatccacggggatgttggtgaagaggttcaaagtgggcattgcgttgtccttgagtccttcaggataaggtaggtggtgtttctcccttcacacacc |
52853174 |
T |
|
| Q |
209 |
aattcgtgttttgaagttgg |
228 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
52853175 |
aattcgtgttttgaagttgg |
52853194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 91; E-Value: 6e-44
Query Start/End: Original strand, 294 - 422
Target Start/End: Original strand, 52853260 - 52853393
Alignment:
| Q |
294 |
ggtccccaactttctaaacattgcaacaagttgtcatttttatcaacaaaaagaaaaagtttgacaataaaatgtttcaatccaactgttattgtt---g |
390 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| | |
|
|
| T |
52853260 |
ggtccccaactttctaa-cattgcaacaagttgtcatttttatcaacaaaaagaaaaagtttgacaataaaatgtttcaatccaagtgttattgttgagg |
52853358 |
T |
|
| Q |
391 |
agcccttggc---aatagttgaaacgagtttggta |
422 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||| |
|
|
| T |
52853359 |
agcccttggcaataatacttgaaacgagtttggta |
52853393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 34 - 155
Target Start/End: Original strand, 52848950 - 52849071
Alignment:
| Q |
34 |
tggactcaacggattcgggctttccgatgatttttgcaacaactttggtggcatccctgagaatgtcggaagcaataacaggatccacggggatgttggt |
133 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||| |||||||||||||||| ||||||| |||||||||||||||||| || |||| |||||| |
|
|
| T |
52848950 |
tggactcaacggattcgggtcttccgatgatgtttgcaatcgctttggtggcatcccttagaatgttggaagcaataacaggatcaacagggacgttggt |
52849049 |
T |
|
| Q |
134 |
gaagaggttcaaagtgggcatt |
155 |
Q |
| |
|
||||||||||||||| |||||| |
|
|
| T |
52849050 |
gaagaggttcaaagtaggcatt |
52849071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University