View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12069_low_2 (Length: 299)
Name: NF12069_low_2
Description: NF12069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12069_low_2 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 88; Significance: 3e-42; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 207 - 298
Target Start/End: Original strand, 3021888 - 3021979
Alignment:
| Q |
207 |
gttgatctttatatatgtaagtgatgtaatctcttgatttaaactacatttctcatattcaatacaattttcatttcattttataacctatg |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3021888 |
gttgatctttatatatgtaagtgatgtaatctcttgatttaaactacatttctcatattcgatacaattttcatttcattttataacctatg |
3021979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 26 - 159
Target Start/End: Original strand, 3021707 - 3021840
Alignment:
| Q |
26 |
actcttcttggatgtggttgattttgtaaaacttacnnnnnnnnnagttaagtttgaaataatattgaagtcgcacataaacatagtttgttggattgaa |
125 |
Q |
| |
|
|||||| ||||||| | ||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3021707 |
actctttttggatgcgattgattttgtaaaacttactttttttttagttcagtttgaaataatattgaagtcgcacataaacatagtttgttggattgaa |
3021806 |
T |
|
| Q |
126 |
catgaaacttgaaccacctaccatataaagagat |
159 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
3021807 |
catgaaacttgaaccacctactatataaagagat |
3021840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 1 - 60
Target Start/End: Original strand, 3038536 - 3038595
Alignment:
| Q |
1 |
tcactttggaacttctctatttgatactcttcttggatgtggttgattttgtaaaactta |
60 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3038536 |
tcactttggaacttctctatttgatactcttcttggatgtggttgattttgtaaaactta |
3038595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University