View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12071_high_32 (Length: 238)
Name: NF12071_high_32
Description: NF12071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12071_high_32 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 8 - 223
Target Start/End: Original strand, 6310402 - 6310616
Alignment:
| Q |
8 |
tatcgtttatggcgaatagtatcatattttgtaaagaatttagattcactttttcatagatgagcatttagcaatgacattcttgtcgggaacagaactc |
107 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6310402 |
tatcgtttatggcgaacagtatcatattttgtaacgaatttagattcactttttcatagatgagcatttagcaatgacattcttgtcgggaacagaactc |
6310501 |
T |
 |
| Q |
108 |
ttctaaagttgtagaacttaaagtagcatatgtttctgtttctaactagccatgcaattgacacctcacatatatagtagagcaagaatgaagtgggatt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6310502 |
ttctaaagttgtagaacttaaagtagcatatgtttctgtttctaactagccatgcaattgacacctcacatatata-tagagcaagaatgaagtgggatt |
6310600 |
T |
 |
| Q |
208 |
acactcataatagtac |
223 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
6310601 |
acactcataatagtac |
6310616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University