View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12071_low_16 (Length: 399)
Name: NF12071_low_16
Description: NF12071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12071_low_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 66; Significance: 5e-29; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 316 - 389
Target Start/End: Original strand, 7581611 - 7581684
Alignment:
| Q |
316 |
ttggtagtgtagagctagcttttgttattgagtaagtcaaaatccaaattctgatgacaaatgtgttctctgct |
389 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
7581611 |
ttggtagtgtagagctagcttttgttattgagtaagtcaaaatccaaattctgataacgaatgtgttctctgct |
7581684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University