View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12071_low_25 (Length: 298)
Name: NF12071_low_25
Description: NF12071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12071_low_25 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 153; Significance: 4e-81; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 129 - 285
Target Start/End: Complemental strand, 42683170 - 42683014
Alignment:
| Q |
129 |
ttggctggagaatagaaaaaggagtgtcaagaacaagctaaagatatagaacgcgagaattgagagcgattgacaacagacacctatgagacccagtaga |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42683170 |
ttggctggagaatagaaaaaggagtgtcaagaacaagataaagatatagaacgcgagaattgagagcgattgacaacagacacctatgagacccagtaga |
42683071 |
T |
|
| Q |
229 |
gaaatctcacattctgtgttagcttgtctggtattccatatccttaaaccaaaaacc |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42683070 |
gaaatctcacattctgtgttagcttgtctggtattccatatccttaaaccaaaaacc |
42683014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 1 - 131
Target Start/End: Complemental strand, 42683341 - 42683218
Alignment:
| Q |
1 |
tctaacctgaataggtgagaagtgctcagtgtagaatttgcgaaagaaatcgttgggacttgggagtttccgaatgaagatcagagcaaaaattttgagg |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
42683341 |
tctaacctgaataggtgagaagttctcagtgtagaatttgcgaaagaaatcgttggga-------gtttccgaatgaagatcagagcaaaaattttgagg |
42683249 |
T |
|
| Q |
101 |
ttgcaaacaactcttaaacgcataccaattg |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
42683248 |
ttgcaaacaactcttaaacgcataccaattg |
42683218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University