View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12071_low_27 (Length: 278)
Name: NF12071_low_27
Description: NF12071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12071_low_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 5 - 261
Target Start/End: Original strand, 39235 - 39491
Alignment:
| Q |
5 |
gagcagagaggtaacttcattcttgtagtcgaagtattgtttgcgcattcattcacaatattttcattattgtgaaggaatttactccagagcatgttct |
104 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39235 |
gagcatagaggtaacttcattcttgtagtcgaagtattgtttgcgcattcattcacaatattttcattattgtgaaggaatttactccagagcatgttct |
39334 |
T |
 |
| Q |
105 |
aatgactttagttcctttttcagaatacaatgattgtactcaaaatgttgtgccaaagccaaaaatctataccgaccgtccacgtgtgtgtatgaagctc |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39335 |
aatgactttagttcctttttcagaatacaatgactgtactcaaaatgttgtgccaaagccaaaaatctataccgaccgtccacgtgtgtgtatgaagctc |
39434 |
T |
 |
| Q |
205 |
agggtagctaacgtcgacaatcttgatgatgagattcaaacagataaacaagtatac |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39435 |
agggtagctaacgtcgacaatcttgatgatgagattcaaacagataaacaagtatac |
39491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University