View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12072_high_9 (Length: 259)
Name: NF12072_high_9
Description: NF12072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12072_high_9 |
 |  |
|
| [»] scaffold0036 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0036 (Bit Score: 228; Significance: 1e-126; HSPs: 2)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 8 - 243
Target Start/End: Original strand, 21614 - 21849
Alignment:
| Q |
8 |
caataacgatgccaaagaaaaaagtacatagaagacggttgtgatggtctctattttttggactcatgctcattacaatcaccatcgataaaccacattt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21614 |
caataacgatgccaaagaaaaaagtacatagaagacggttgtgatggtctctattttttggactcatgctcattacaatcaccatcgataaaccacattt |
21713 |
T |
 |
| Q |
108 |
aatagctttatttgagaaaatagtaattggaaacttaggtcttggaacaatcagttggagaaaaggaaactgtttttcctttgagatcgtacccaactaa |
207 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21714 |
aatagctttatttcaaaaaatagtaattggaaacttaggtcttggaacaatcagttggagaaaaggaaactgtttttcctttgagatcgtacccaactaa |
21813 |
T |
 |
| Q |
208 |
aaaattaaattgtgctctatttccaaagatggaaat |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
21814 |
aaaattaaattgtgctctatttccaaagatggaaat |
21849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 147 - 242
Target Start/End: Original strand, 13715 - 13810
Alignment:
| Q |
147 |
tcttggaacaatcagttggagaaaaggaaactgtttttcctttgagatcgtacccaactaaaaaattaaattgtgctctatttccaaagatggaaa |
242 |
Q |
| |
|
|||||||||||||| |||||| |||||||||| |||| |||| |||||| || | |||| ||||| || |||||| |||||||||||||||||| |
|
|
| T |
13715 |
tcttggaacaatcacttggagcaaaggaaacttttttcccttcgagatcatattctactagaaaatcaacgtgtgctatatttccaaagatggaaa |
13810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University