View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12072_low_10 (Length: 256)
Name: NF12072_low_10
Description: NF12072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12072_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 230; Significance: 1e-127; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 20 - 253
Target Start/End: Original strand, 32733130 - 32733363
Alignment:
| Q |
20 |
tctcctatacccatcactccctttggaaaacaacagcacatttgcctcacgcctcagagacatcatagacagtggtgaatcaagacctatagatataggc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32733130 |
tctcctatacccatcactccctttggaaaacaacagcacatttgcctcacgcctcagagacatcatagacagtggtgaatcaagacctatagatataggc |
32733229 |
T |
 |
| Q |
120 |
aaaaattcagacacaatgagaaccctttgtaactctgtggtttccttagcatggagaagtaacaatggtactccaactgatgtttgtcattgggtagatg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32733230 |
aaaaattcagacacaatgagaaccctttgtaactctgtggtttccttagcatggagaagtaacaatggtactccaactgatgtttgtcattgggtagatg |
32733329 |
T |
 |
| Q |
220 |
gatttcctttcaatcttcatctatacacttctct |
253 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
32733330 |
gattccctttcaatcttcatctatacacttctct |
32733363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 118 - 239
Target Start/End: Complemental strand, 16795130 - 16795009
Alignment:
| Q |
118 |
gcaaaaattcagacacaatgagaaccctttgtaactctgtggtttccttagcatggagaagtaacaatggtactccaactgatgtttgtcattgggtaga |
217 |
Q |
| |
|
||||||| || |||||||||||||| ||| |||||||||| ||||| |||||||||||| || ||||| || ||| ||||||||||||| |||| || |
|
|
| T |
16795130 |
gcaaaaactccgacacaatgagaacacttggtaactctgttgtttcattagcatggagaggtccaaatggaacaccagctgatgtttgtcactgggctga |
16795031 |
T |
 |
| Q |
218 |
tggatttcctttcaatcttcat |
239 |
Q |
| |
|
|||||| ||||| ||| ||||| |
|
|
| T |
16795030 |
tggattccctttaaatattcat |
16795009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University