View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12072_low_13 (Length: 203)
Name: NF12072_low_13
Description: NF12072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12072_low_13 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 115; Significance: 1e-58; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 89 - 203
Target Start/End: Original strand, 3734323 - 3734437
Alignment:
| Q |
89 |
agggttcagtttactgaatacattcaaaagaacgttgctttgtatcaatttcgtaatgggatccctctcaccactgctgcagctgctaatttcactcgtg |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3734323 |
agggttcagtttactgaatacattcaaaagaacgttgctttgtatcaatttcgtaatgggatccctctcaccactgctgcagctgctaatttcactcgtg |
3734422 |
T |
|
| Q |
189 |
gcgaactcgccactg |
203 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
3734423 |
gcgaactcgccactg |
3734437 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 89 - 201
Target Start/End: Original strand, 1101752 - 1101864
Alignment:
| Q |
89 |
agggttcagtttactgaatacattcaaaagaacgttgctttgtatcaatttcgtaatgggatccctctcaccactgctgcagctgctaatttcactcgtg |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
1101752 |
agggttcagtttactgaatacattcaaaagaacgttgctttgtatcaattccgtaatgggatccctctcaccactgctgccgcagctaatttcactcgtg |
1101851 |
T |
|
| Q |
189 |
gcgaactcgccac |
201 |
Q |
| |
|
|||| |||||||| |
|
|
| T |
1101852 |
gcgagctcgccac |
1101864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University