View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12073_high_30 (Length: 251)
Name: NF12073_high_30
Description: NF12073
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12073_high_30 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 1 - 166
Target Start/End: Complemental strand, 6729488 - 6729326
Alignment:
| Q |
1 |
acaataattatagtcaattaaagattatttgttaacnnnnnnnngttgcaaatattaatagtgatcagttgttaggtttgattagattaatatttactca |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
6729488 |
acaataattatagttaattaaagattatttgttaactcttttttgttgcaaatattaatagtga---gttgttaggttagattagattaatatttactca |
6729392 |
T |
 |
| Q |
101 |
ttcgtttaaatttgaatcgacatccgatttctttaactattagctcaaaccaattaaactagtcaa |
166 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
6729391 |
ttcgtttaaatttgaatcgacatccgatttctttaactattagctcaaatcaattaaactactcaa |
6729326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 81 - 117
Target Start/End: Original strand, 606815 - 606851
Alignment:
| Q |
81 |
attagattaatatttactcattcgtttaaatttgaat |
117 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
606815 |
attatattaatatttactcattcatttaaatttgaat |
606851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University