View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12073_high_37 (Length: 225)
Name: NF12073_high_37
Description: NF12073
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12073_high_37 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 23 - 181
Target Start/End: Original strand, 54304662 - 54304820
Alignment:
| Q |
23 |
tgtaaattaacatgttattattactattttctcaaggtggtgctgatgcatactctgtctgtgccattactattatgaaagctcatcaataatcttaaca |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
54304662 |
tgtaaattaacatgttattattactattttctcaaggtggtgctgatgcatactctgtctgtgccattactattatgaaagctcatcgataatcttaaca |
54304761 |
T |
|
| Q |
123 |
aagtgataaaataatttccaccgtagattcaagtttttgtgagtgttgattattttaga |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54304762 |
aagtgataaaataatttccaccgtagattcaagtttttgtgagtgttgattattttaga |
54304820 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University