View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12073_low_12 (Length: 423)
Name: NF12073_low_12
Description: NF12073
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12073_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 311; Significance: 1e-175; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 19 - 370
Target Start/End: Complemental strand, 37597590 - 37597248
Alignment:
| Q |
19 |
gtaatttgacatatgtatgtgtcagcttattgttgaagttaaccacttgaacatgttccaactcaatgaactcatcctttgatcattcattgtcatccaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37597590 |
gtaatttgacatatgtatgtgtcagcttattgttgaagttaaccacttgaacatgttccaactcaatgaactcatcctttgatcattcattgtcatccaa |
37597491 |
T |
 |
| Q |
119 |
caacattttcagtttttgtcactgtatacaacaaaacaaaacctttggtctttggttaatgatttaaccttttttgttcaaggcaagcatggtaatttta |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37597490 |
caacattttcagtttttgtcactgtatacaacaaaac-----ctttggtctttggttaatgatttaaccttttttgttcaaggcaagcatggtaatttta |
37597396 |
T |
 |
| Q |
219 |
ggtgatttagttcttgaggttaccctgtttgtatgctggataaaaatcaggttcttgtttgtatttgtctttctttagagattgatatcccctagctagg |
318 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37597395 |
gatgatttagttcttgaggttaccctgtttgtatgctggataaaaatcaggttcttgtttgtatttgtctttctttagagattgatatcccctagctagg |
37597296 |
T |
 |
| Q |
319 |
gaacataatgtgagctggccggctagaagatgacattactaagtgcatttct |
370 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
37597295 |
gaacataatgtgagct----ggctagaagatgacattactaagtgcatttct |
37597248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 370 - 405
Target Start/End: Complemental strand, 37597212 - 37597177
Alignment:
| Q |
370 |
ttcaacaaaatcatgatgtcatcttaatttcgttat |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
37597212 |
ttcaacaaaatcatgatgtcatcttaatttcgttat |
37597177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University