View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12073_low_20 (Length: 312)
Name: NF12073_low_20
Description: NF12073
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12073_low_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 14 - 296
Target Start/End: Complemental strand, 41847613 - 41847332
Alignment:
| Q |
14 |
gatgaaaaatattgtaaggagggtaaaaccacataagcactgctccgtccgttgtacaaaatttagtaaggatctcatctatatttactattgacaatta |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41847613 |
gatgaaaaatattgtaaggagggtaaaaccacataagcattgctccgtccgttgtacaaa-tttagtaaggatctcatctatatttactattgacaatta |
41847515 |
T |
 |
| Q |
114 |
atgcgatcaagtactagcttgcgatccacctcacagatgacttgtgagaaaccaaaagaagctgtccattacttgaaggttccacaagcctctcctttca |
213 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
41847514 |
atgtgatcaagtactagcttgcgatccacctcacagatgacttgtgagaaaccaaaagaagctatccattacttgaaggttccacaagcctctcctttca |
41847415 |
T |
 |
| Q |
214 |
ctggtttcacgtttccaagctctccaatctccgtcgtagctgccgtttgcttgaatgattcgttgttaaaatatcccaaatat |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41847414 |
ctggtttcacgtttccaagctctccaatctccgtcgtagctaccgtttgcttgaatgattcgttgttaaaatatcccaaatat |
41847332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University