View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12073_low_24 (Length: 299)
Name: NF12073_low_24
Description: NF12073
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12073_low_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 281
Target Start/End: Complemental strand, 49187291 - 49187014
Alignment:
| Q |
1 |
cttcttcatcaccattctctgctttcgaatcaatatgttttgataagagactctcctccatcactcttctctcttcacccattttcnnnnnnnnnnnnnn |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49187291 |
cttcttcatcaccattctctgctttcgaatcaatatgttttgataagagactctcctccatcactcttctctcttcacccattttcagagaagaagaaga |
49187192 |
T |
 |
| Q |
101 |
nnnnnnntacgggattgagattggaaagagagatatataaatagagtcggtaacgtatgacagtgttttgggtctctcgtgtctggtgcctttcgcctgt |
200 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
49187191 |
agaa---tacgtgattgagattggatagagagatatataaatagagtcggtaacgtatgacagtgttttgtgtctctcgtgtctggtgcctttcgcctgt |
49187095 |
T |
 |
| Q |
201 |
caatttatattcaaattcaattttggtttttactatatacacccaatataaatcattctataaaatattttaacctttcat |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49187094 |
caatttatattcaaattcaattttggtttttactatatacacccaatataaatcattctataaaatattttaacctttcat |
49187014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University