View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12073_low_34 (Length: 243)

Name: NF12073_low_34
Description: NF12073
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12073_low_34
NF12073_low_34
[»] chr1 (4 HSPs)
chr1 (142-229)||(33857428-33857515)
chr1 (142-229)||(33923408-33923495)
chr1 (1-29)||(33857559-33857587)
chr1 (1-29)||(33923336-33923364)


Alignment Details
Target: chr1 (Bit Score: 88; Significance: 2e-42; HSPs: 4)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 142 - 229
Target Start/End: Complemental strand, 33857515 - 33857428
Alignment:
Q  142 tggagcaaaactaaacttcaacagaggaagaaccttggatggtttggagaagttttgttgtgagatgaattcttcttttagttgatgt 229  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  33857515 tggagcaaaactaaacttcaacagaggaagaaccttggatggtttggagaagttttgttgtgagatgaattcttcttttagttgatgt 33857428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 142 - 229
Target Start/End: Original strand, 33923408 - 33923495
Alignment:
Q  142 tggagcaaaactaaacttcaacagaggaagaaccttggatggtttggagaagttttgttgtgagatgaattcttcttttagttgatgt 229  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  33923408 tggagcaaaactaaacttcaacagaggaagaaccttggatggtttggagaagttttgttgtgagatgaattcttcttttagttgatgt 33923495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 29
Target Start/End: Complemental strand, 33857587 - 33857559
Alignment:
Q  1 caaatagcttccaaagctcacccctaact 29  Q
    |||||||||||||||||||||||||||||    
T  33857587 caaatagcttccaaagctcacccctaact 33857559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 29
Target Start/End: Original strand, 33923336 - 33923364
Alignment:
Q  1 caaatagcttccaaagctcacccctaact 29  Q
    |||||||||||||||||||||||||||||    
T  33923336 caaatagcttccaaagctcacccctaact 33923364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University