View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12073_low_35 (Length: 242)
Name: NF12073_low_35
Description: NF12073
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12073_low_35 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 231; Significance: 1e-128; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 231; E-Value: 1e-128
Query Start/End: Original strand, 12 - 242
Target Start/End: Original strand, 47458412 - 47458642
Alignment:
| Q |
12 |
aaatccaactccaaccttgtcaacttctctcagagaaaaacaacaaactagttctggttccggtagcaatatcaataattcgtcaggtagggttcaaccg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47458412 |
aaatccaactccaaccttgtcaacttctctcagagaaaaacaacaaactagttctggttccggtagcaatatcaataattcgtcaggtagggttcaaccg |
47458511 |
T |
 |
| Q |
112 |
gggggtgtgaatggcaatttcgtgtattatttgccgcaagatgaagctgtcgctgctggttttggtgctgaagatggtggattggatgcccttgaatctc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47458512 |
gggggtgtgaatggcaatttcgtgtattatttgccgcaagatgaagctgtcgctgctggttttggtgctgaagatggtggattggatgcccttgaatctc |
47458611 |
T |
 |
| Q |
212 |
agaaagttgttgatcttctcaattctcagtt |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
47458612 |
agaaagttgttgatcttctcaattctcagtt |
47458642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University