View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12074_high_2 (Length: 235)
Name: NF12074_high_2
Description: NF12074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12074_high_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 2198252 - 2198472
Alignment:
| Q |
1 |
ttcgcgatcgttgttgagacatggcgcagaaaagattcatcattgaggttgaaaaagcgaaggcagcaacggaggataaaccttcaagaggacctgctta |
100 |
Q |
| |
|
||||| |||||| ||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
2198252 |
ttcgctatcgttattgagccatggcgcaggaaagattcatcattgaggttgaaaaagcgaaggcagcaacggaggataaaccttcaagaggacctgcgta |
2198351 |
T |
 |
| Q |
101 |
tcgtagcatcttcgctaaagatggttttcctcctcctattcctggtcttgatagttgctgggatgtttttcggttagtttcgatgcaaatcaatgttcat |
200 |
Q |
| |
|
||| || ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2198352 |
tcgcagtatcttcgctaaggatggatttcctcctcctattcctggtcttgatagttgctgggatgtttttcggttagtttcgatgcaaatcaatgttcat |
2198451 |
T |
 |
| Q |
201 |
ttcaattttccatgtcgattt |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
2198452 |
ttcaattttccatgtcgattt |
2198472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 2 - 180
Target Start/End: Original strand, 2210468 - 2210646
Alignment:
| Q |
2 |
tcgcgatcgttgttgagacatggcgcagaaaagattcatcattgaggttgaaaaagcgaaggcagcaacggaggataaaccttcaagaggacctgcttat |
101 |
Q |
| |
|
|||||||| | |||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||| ||| |
|
|
| T |
2210468 |
tcgcgatcatcgttgagccatggcgcagaaaagattcatcattgaggttgaaaaagcgaaggaagcaacggaagataaaccttcaagaggacctgcgtat |
2210567 |
T |
 |
| Q |
102 |
cgtagcatcttcgctaaagatggttttcctcctcctattcctggtcttgatagttgctgggatgtttttcggttagttt |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2210568 |
cgtagcatcttcgctaaagatggttttcctcctcctattcttggtcttgatagttgctgggatgtttttcggttagttt |
2210646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University