View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12075_low_7 (Length: 383)
Name: NF12075_low_7
Description: NF12075
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12075_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 141; Significance: 8e-74; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 141; E-Value: 8e-74
Query Start/End: Original strand, 6 - 146
Target Start/End: Original strand, 4673280 - 4673420
Alignment:
| Q |
6 |
aacttccgtctagccactccggtgactttgctccggggaaccataatggacgatcagtacctgttagatataattaaagatccgttaaaattagttttaa |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4673280 |
aacttccgtctagccactccggtgactttgctccggggaaccataatggacgatcagtacctgttagatataattaaagatccgttaaaattagttttaa |
4673379 |
T |
 |
| Q |
106 |
agattcgttagaattagttttatattgtttaagttagttac |
146 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4673380 |
agattcgttagaattagttttatattgtttaagttagttac |
4673420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 320 - 368
Target Start/End: Original strand, 4673593 - 4673641
Alignment:
| Q |
320 |
gaatctttaattatatctaacgtacttggacttgatctggatggtttct |
368 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4673593 |
gaatctttaattatatctaacgtacttggacttgatctggatggtttct |
4673641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University