View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12075_low_7 (Length: 383)

Name: NF12075_low_7
Description: NF12075
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12075_low_7
NF12075_low_7
[»] chr4 (2 HSPs)
chr4 (6-146)||(4673280-4673420)
chr4 (320-368)||(4673593-4673641)


Alignment Details
Target: chr4 (Bit Score: 141; Significance: 8e-74; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 141; E-Value: 8e-74
Query Start/End: Original strand, 6 - 146
Target Start/End: Original strand, 4673280 - 4673420
Alignment:
6 aacttccgtctagccactccggtgactttgctccggggaaccataatggacgatcagtacctgttagatataattaaagatccgttaaaattagttttaa 105  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4673280 aacttccgtctagccactccggtgactttgctccggggaaccataatggacgatcagtacctgttagatataattaaagatccgttaaaattagttttaa 4673379  T
106 agattcgttagaattagttttatattgtttaagttagttac 146  Q
    |||||||||||||||||||||||||||||||||||||||||    
4673380 agattcgttagaattagttttatattgtttaagttagttac 4673420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 320 - 368
Target Start/End: Original strand, 4673593 - 4673641
Alignment:
320 gaatctttaattatatctaacgtacttggacttgatctggatggtttct 368  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
4673593 gaatctttaattatatctaacgtacttggacttgatctggatggtttct 4673641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University