View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12077_high_29 (Length: 237)
Name: NF12077_high_29
Description: NF12077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12077_high_29 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 1 - 120
Target Start/End: Complemental strand, 34995241 - 34995122
Alignment:
| Q |
1 |
aggatttgtattgaattgggtgaaattgagaggatgaccacataaccagaaattgatttaaaacccgagccttgtttagttagatcccatgcttatatgt |
100 |
Q |
| |
|
|||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34995241 |
aggacttgtattgaattaggtgaaattgagaggatgaccacataaccagaaattgatttaaaacccgagccttgtttagttagatcccatgcttatatgt |
34995142 |
T |
|
| Q |
101 |
aattgaattgttaaggatga |
120 |
Q |
| |
|
|| ||||||||||||||||| |
|
|
| T |
34995141 |
aaatgaattgttaaggatga |
34995122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 121 - 223
Target Start/End: Complemental strand, 34995049 - 34994947
Alignment:
| Q |
121 |
attgttacttaaccttcacttttccaaacaatgtaaaacttccaactctcactcgccacaaatatgaggcactgtgatttttctctgtttaaatcctcca |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
34995049 |
attgttacttaaccttcacttttccaaacaatgtaaaacttccaactctcactcgccacaaatatgaggcaccgtgatttttctctgtttaaatcctcca |
34994950 |
T |
|
| Q |
221 |
ggt |
223 |
Q |
| |
|
||| |
|
|
| T |
34994949 |
ggt |
34994947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University