View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12077_high_33 (Length: 219)
Name: NF12077_high_33
Description: NF12077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12077_high_33 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 114; Significance: 5e-58; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 86 - 199
Target Start/End: Complemental strand, 30371347 - 30371234
Alignment:
| Q |
86 |
ctatatataggtaaatttagagtatcaacttcaatgtgaaaacaacctatttcactttattaattatcattttctcttcacttaggatcttggtagatga |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30371347 |
ctatatataggtaaatttagagtatcaacttcaatgtgaaaacaacctatttcactttattaattatcattttctcttcacttaggatcttggtagatga |
30371248 |
T |
 |
| Q |
186 |
aactcataacacta |
199 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
30371247 |
aactcataacacta |
30371234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University