View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12077_high_5 (Length: 515)
Name: NF12077_high_5
Description: NF12077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12077_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 465; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 465; E-Value: 0
Query Start/End: Original strand, 1 - 498
Target Start/End: Complemental strand, 4569816 - 4569319
Alignment:
| Q |
1 |
tcactctcgaatccgtaaactacctcgacgacgacccatcttcccattttgttgaacagttagtacccgacccaaaaccggaagaaggattaaaccatcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4569816 |
tcactctcgaatccgtaaactacctcgacgacgacccatcttcccattttgttgaacagttagtacccgacccaaaaccggaagaaggattaaaccatcc |
4569717 |
T |
 |
| Q |
101 |
atgcatgcttcaactcactgtttacaagtgcggtgggttcactctcggtgcagcaattcaccattcactttgtgatggaatgggtgggacgcnnnnnnnc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
4569716 |
atgcatgcttcaactcactgtttacaagtgcggtgggttcactctcggtgcagcaattcaccattcactttgtgatggaatgggtgggacgctttttttc |
4569617 |
T |
 |
| Q |
201 |
aacacggtggcggagttggctcgtggcggggaacatatcatggtggagccagtgtgggatagagagaagttgttgggtccaagggatgtgccacgagtgg |
300 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4569616 |
aacacgatggcggagttggctcgtggcggggaacatatcatggtggagccagtgtgggatagagagaagttgttgggtccaagggatgtgccacgagtgg |
4569517 |
T |
 |
| Q |
301 |
attcggcgttggtaagagagtttttgagtttggataaagagtttttggtgtatgaagaagatgatggtggttttgtgagagagtgttttcatgtgaagga |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4569516 |
attcggcgttggtaagagagtttttgagtttggataaagagtttttggtgtatgaagaaggtgatggtggtgttgtgagagagtgttttcatgtgaagga |
4569417 |
T |
 |
| Q |
401 |
tgagtgtttggaagagtttaagagatctttgtttgatcaatgtgggttcaagttcaccacttttgaagctttaggtgcttgcatttggaggtccaagt |
498 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4569416 |
tgagtgtttggaagagtttaagagatctttgtttgatcaatgtgggttcaagttcaccacttttgaagctttaggtgcttgcatttggaggtccaagt |
4569319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University