View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12077_low_20 (Length: 295)
Name: NF12077_low_20
Description: NF12077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12077_low_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 1 - 279
Target Start/End: Complemental strand, 38338505 - 38338228
Alignment:
| Q |
1 |
atatgagacttgtggagttctagtgtgccatctaacattcaagtttaggtgtgcattatttgcctttaaaaaatggaaaatgtgacacaattatggttag |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38338505 |
atatgagaattgtggagttctagtgtgccatctaacattcaagttttggtgtgcattatttgcctttaataaatggaaaatgtgacacaattatggttag |
38338406 |
T |
 |
| Q |
101 |
ggacatcaatgccattgaacatggttggaggaatactgatatgacttggtgtttgtggctggtgcgaaatgacgtcgttttcaaatggacatcatcatac |
200 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
38338405 |
ggacatcaatgccattgaacatgtttggaggaatactgatatgacttggtgtttgtggctggtgcgaaatgacgtcgttttcaaa-ggacagcatcatac |
38338307 |
T |
 |
| Q |
201 |
ttggcattttgtttgtagttagaaataaatctttccttttagtgttcctaaccctttgtcttgctttcgaagtgcttaa |
279 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38338306 |
ttggcattttgtttgtagttagagataaatctttccttttagtgttcctaaccctttgtcttgctttcgaagtgcttaa |
38338228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University