View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12077_low_24 (Length: 252)
Name: NF12077_low_24
Description: NF12077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12077_low_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 5232096 - 5232332
Alignment:
| Q |
1 |
caactttcgggtcagtatgccttttcttctttagaaattccttcatgataaattcaatttataaattctaaattaaaaagttatatatgaatgtaggaac |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5232096 |
caactttcaggtcagtatgccttttcttctttagaaattccttcatgataaattcaatttataaattctaaattaacaagttatatatgaatgtaggaac |
5232195 |
T |
 |
| Q |
101 |
tgtgtatggaggattggacaatcctaaagtaacattcagcgaaagtgtgaacctaaaggtcggcaataacaagatttctttacttagtgttgctgtgggt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5232196 |
tgtgtatggaggattggacaatcctaaagtaacattcagtgaaagtgtgaacctaaaggtcggcaataacaagatttctttacttagtgttgctgtgggt |
5232295 |
T |
 |
| Q |
201 |
cttccggttagtattctcttttttggcgcacacccct |
237 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
5232296 |
cttccggttagtattctcttttttgacgcacacccct |
5232332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 88 - 212
Target Start/End: Original strand, 17128138 - 17128262
Alignment:
| Q |
88 |
tgaatgtaggaactgtgtatggaggattggacaatcctaaagtaacattcagcgaaagtgtgaacctaaaggtcggcaataacaagatttctttacttag |
187 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||||||| | ||||| ||| | || ||||| | | ||| |||||||||||||||||| ||||||| |
|
|
| T |
17128138 |
tgaatgtaggaactgcgtatggatcattggacaatcctaaattgacatttagcaacagcgtgaagttgagggttggcaataacaagatttctctacttag |
17128237 |
T |
 |
| Q |
188 |
tgttgctgtgggtcttccggttagt |
212 |
Q |
| |
|
|||||| || |||||| |||||||| |
|
|
| T |
17128238 |
tgttgccgtcggtctttcggttagt |
17128262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University