View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12077_low_26 (Length: 249)
Name: NF12077_low_26
Description: NF12077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12077_low_26 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 117; Significance: 1e-59; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 84 - 240
Target Start/End: Original strand, 32358987 - 32359137
Alignment:
| Q |
84 |
tgtgcaattgtaacaagctgctgcaaatttcattaaccctatacagctgaatataagcaagctttcatctttttattcaagttgtataactagaagctta |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32358987 |
tgtgcaattgtaacaagctgctgcaaatttcattaaccctattcagctgaatat----aagctttcatctttttattcaagttgtataactagaagctta |
32359082 |
T |
|
| Q |
184 |
atgctctgattgtatgataaactagtcatttgttggattttcaattattgctctctg |
240 |
Q |
| |
|
||| |||||||||||||||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
32359083 |
atg--ctgattgtatgataaactagtcatttgttgaattttcaattactgctctctg |
32359137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 82
Target Start/End: Original strand, 32358836 - 32358917
Alignment:
| Q |
1 |
tggaaagtgtaatgatttctgaaagagtgcaccagttttggaggaaagattgcacagatgtatgaaggttgtcaattcattt |
82 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||| ||||||||| ||| |||||||||||||||| |||||| |
|
|
| T |
32358836 |
tggaaagcgtaatgatttctgaaagagtgcaccagttttggaggcaagattgcatagaagtatgaaggttgtcaactcattt |
32358917 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 12 - 88
Target Start/End: Original strand, 32372433 - 32372509
Alignment:
| Q |
12 |
atgatttctgaaagagtgcaccagttttggaggaaagattgcacagatgtatgaaggttgtcaattcatttatgtgc |
88 |
Q |
| |
|
||||||||||||||| | ||||| |||||||||||||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
32372433 |
atgatttctgaaagactacaccacttttggaggaaagattgcacagatgtatgaaggttgtcaactcatttttgtgc |
32372509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University