View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12077_low_29 (Length: 237)

Name: NF12077_low_29
Description: NF12077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12077_low_29
NF12077_low_29
[»] chr2 (2 HSPs)
chr2 (1-120)||(34995122-34995241)
chr2 (121-223)||(34994947-34995049)


Alignment Details
Target: chr2 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 1 - 120
Target Start/End: Complemental strand, 34995241 - 34995122
Alignment:
1 aggatttgtattgaattgggtgaaattgagaggatgaccacataaccagaaattgatttaaaacccgagccttgtttagttagatcccatgcttatatgt 100  Q
    |||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34995241 aggacttgtattgaattaggtgaaattgagaggatgaccacataaccagaaattgatttaaaacccgagccttgtttagttagatcccatgcttatatgt 34995142  T
101 aattgaattgttaaggatga 120  Q
    || |||||||||||||||||    
34995141 aaatgaattgttaaggatga 34995122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 121 - 223
Target Start/End: Complemental strand, 34995049 - 34994947
Alignment:
121 attgttacttaaccttcacttttccaaacaatgtaaaacttccaactctcactcgccacaaatatgaggcactgtgatttttctctgtttaaatcctcca 220  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
34995049 attgttacttaaccttcacttttccaaacaatgtaaaacttccaactctcactcgccacaaatatgaggcaccgtgatttttctctgtttaaatcctcca 34994950  T
221 ggt 223  Q
    |||    
34994949 ggt 34994947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University