View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12077_low_35 (Length: 204)
Name: NF12077_low_35
Description: NF12077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12077_low_35 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 152; Significance: 1e-80; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 20 - 191
Target Start/End: Complemental strand, 2998423 - 2998252
Alignment:
| Q |
20 |
ttgaccacatgtactttccgttgccatggaaaagatcgttgttgaagttaccaacgtagatatccccattggattttgtcagggtgtcgtgaccatgacg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
2998423 |
ttgaccacatgtactttccgttgccatggaaaagatcgttatcgaagttaccaacgtagatatccccatcggattttgtcagggtgtcgtgactatgacg |
2998324 |
T |
 |
| Q |
120 |
ggaattcatggagaattcaccctcaaaacttgttcttgatggatatatgatccgtcctttccctgtcctttg |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
2998323 |
ggaattcatggagaattcaccctcaaaacttgttcctgatggatatatgatccgtcctttccctgtcctttg |
2998252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 29 - 189
Target Start/End: Complemental strand, 2998621 - 2998461
Alignment:
| Q |
29 |
tgtactttccgttgccatggaaaagatcgttgttgaagttaccaacgtagatatccccattggattttgtcagggtgtcgtgaccatgacgggaattcat |
128 |
Q |
| |
|
|||||||||| |||||||| |||| ||| || | |||||||||||||||||||||||||||||||||||| |||||| || ||||||||||||| ||| | |
|
|
| T |
2998621 |
tgtactttcccttgccatgaaaaatatcattctcgaagttaccaacgtagatatccccattggattttgtaagggtgccgcgaccatgacgggagttctt |
2998522 |
T |
 |
| Q |
129 |
ggagaattcaccctcaaaacttgttcttgatggatatatgatccgtcctttccctgtcctt |
189 |
Q |
| |
|
||||||||||||||||||| ||| || ||||| |||||||||||| ||||||||||||||| |
|
|
| T |
2998521 |
ggagaattcaccctcaaaaattgatcctgatgaatatatgatccgacctttccctgtcctt |
2998461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 20 - 190
Target Start/End: Complemental strand, 2998010 - 2997840
Alignment:
| Q |
20 |
ttgaccacatgtactttccgttgccatggaaaagatcgttgttgaagttaccaacgtagatatccccattggattttgtcagggtgtcgtgaccatgacg |
119 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||| || | |||||||||| | ||| |||||||||||||||||| || ||| | ||||||||||| |
|
|
| T |
2998010 |
ttgaccatgtgtactttcccttgccatggaaaagatcattttcaaagttaccaatgaagacatccccattggattttgtaagagtgccatgaccatgacg |
2997911 |
T |
 |
| Q |
120 |
ggaattcatggagaattcaccctcaaaacttgttcttgatggatatatgatccgtcctttccctgtccttt |
190 |
Q |
| |
|
|||||| | ||||||||||||||||||||| |||||| |||| ||||| | |||||||||| ||||||| |
|
|
| T |
2997910 |
agaattcctaaagaattcaccctcaaaacttgctcttgacggatttatgaccggtcctttcccagtccttt |
2997840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 41 - 187
Target Start/End: Complemental strand, 2998196 - 2998050
Alignment:
| Q |
41 |
tgccatggaaaagatcgttgttgaagttaccaacgtagatatccccattggattttgtcagggtgtcgtgaccatgacgggaattcatggagaattcacc |
140 |
Q |
| |
|
|||||||||||| || ||| | |||||||||| |||||||||||||| |||||| | |||||| ||| ||||| ||||||||| | ||||||||||| |
|
|
| T |
2998196 |
tgccatggaaaatattgttctcaaagttaccaatgtagatatccccatcagattttttaagggtgccgtaaccattacgggaatttctcgagaattcacc |
2998097 |
T |
 |
| Q |
141 |
ctcaaaacttgttcttgatggatatatgatccgtcctttccctgtcc |
187 |
Q |
| |
|
||||||| ||||| || |||||||||| || |||||||||||||||| |
|
|
| T |
2998096 |
ctcaaaaattgttttttatggatatattattcgtcctttccctgtcc |
2998050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 90; Significance: 1e-43; HSPs: 6)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 29 - 190
Target Start/End: Complemental strand, 32716904 - 32716743
Alignment:
| Q |
29 |
tgtactttccgttgccatggaaaagatcgttgttgaagttaccaacgtagatatccccattggattttgtcagggtgtcgtgaccatgacgggaattcat |
128 |
Q |
| |
|
|||||||||| ||||||||||||||||| | | ||||||||||||||||||| |||||| ||||||| | || ||| |||||||||||||||||||| | |
|
|
| T |
32716904 |
tgtactttcctttgccatggaaaagatcactctcgaagttaccaacgtagatacccccatcggattttttaagagtgccgtgaccatgacgggaattcct |
32716805 |
T |
 |
| Q |
129 |
ggagaattcaccctcaaaacttgttcttgatggatatatgatccgtcctttccctgtccttt |
190 |
Q |
| |
|
|||||| |||||||||||||| || |||||||||||||||||| |||||||||||||||| |
|
|
| T |
32716804 |
aaagaattgaccctcaaaacttgctcctgatggatatatgatccgccctttccctgtccttt |
32716743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 23 - 190
Target Start/End: Complemental strand, 32716703 - 32716536
Alignment:
| Q |
23 |
accacatgtactttccgttgccatggaaaagatcgttgttgaagttaccaacgtagatatccccattggattttgtcagggtgtcgtgaccatgacggga |
122 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||| | | ||||||||||||||||||| |||||| ||||||| | || ||| || ||||||||||||| |
|
|
| T |
32716703 |
accacgtgtactttcccttgccatggaaaagatcactctcgaagttaccaacgtagatacccccatcggattttttaagagtgccgcgaccatgacggga |
32716604 |
T |
 |
| Q |
123 |
attcatggagaattcaccctcaaaacttgttcttgatggatatatgatccgtcctttccctgtccttt |
190 |
Q |
| |
|
|||| | |||||| |||||||||||||| || |||||||||||||||||| |||||||||||||||| |
|
|
| T |
32716603 |
attcctaaagaattgaccctcaaaacttgctcctgatggatatatgatccgccctttccctgtccttt |
32716536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 29 - 182
Target Start/End: Complemental strand, 32717318 - 32717165
Alignment:
| Q |
29 |
tgtactttccgttgccatggaaaagatcgttgttgaagttaccaacgtagatatccccattggattttgtcagggtgtcgtgaccatgacgggaattcat |
128 |
Q |
| |
|
|||||||||| ||||||||| ||||||| | | ||||||||||| |||||||||||||| |||||| | |||||| |||||||||||||||||||| |
|
|
| T |
32717318 |
tgtactttcctttgccatggtaaagatcactctcgaagttaccaatgtagatatccccatcagattttttaagggtgccgtgaccatgacgggaattccc |
32717219 |
T |
 |
| Q |
129 |
ggagaattcaccctcaaaacttgttcttgatggatatatgatccgtcctttccc |
182 |
Q |
| |
|
||||||||||||||||||| ||| || |||||||||||||||| | |||||||| |
|
|
| T |
32717218 |
ggagaattcaccctcaaaagttgatcctgatggatatatgatctgacctttccc |
32717165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 29 - 189
Target Start/End: Complemental strand, 32717111 - 32716951
Alignment:
| Q |
29 |
tgtactttccgttgccatggaaaagatcgttgttgaagttaccaacgtagatatccccattggattttgtcagggtgtcgtgaccatgacgggaattcat |
128 |
Q |
| |
|
|||||||||| ||||||| ||||||||| | ||||||||||||| ||||| || |||||||||| | || |||||| | |||||||||||||||||| | |
|
|
| T |
32717111 |
tgtactttcccttgccattgaaaagatcactcttgaagttaccaatgtagacatgcccattggatatggtaagggtgccttgaccatgacgggaattcct |
32717012 |
T |
 |
| Q |
129 |
ggagaattcaccctcaaaacttgttcttgatggatatatgatccgtcctttccctgtcctt |
189 |
Q |
| |
|
|||||| ||||||||||||||||| |||| ||||||| || | ||||||||||||||| |
|
|
| T |
32717011 |
aaagaattgaccctcaaaacttgttcctgatagatatatcatttgccctttccctgtcctt |
32716951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 107 - 189
Target Start/End: Complemental strand, 32717447 - 32717365
Alignment:
| Q |
107 |
cgtgaccatgacgggaattcatggagaattcaccctcaaaacttgttcttgatggatatatgatccgtcctttccctgtcctt |
189 |
Q |
| |
|
||||||||||| ||||||| | |||||||||||||||||||||| || |||||||||||| ||||||||||||||||||||| |
|
|
| T |
32717447 |
cgtgaccatgaaaggaattcctagagaattcaccctcaaaacttgctcctgatggatatattatccgtcctttccctgtcctt |
32717365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 146 - 190
Target Start/End: Complemental strand, 32714166 - 32714122
Alignment:
| Q |
146 |
aacttgttcttgatggatatatgatccgtcctttccctgtccttt |
190 |
Q |
| |
|
|||||| || |||||||||||||||||| |||||||||||||||| |
|
|
| T |
32714166 |
aacttgctcctgatggatatatgatccgccctttccctgtccttt |
32714122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 74; Significance: 4e-34; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 29 - 186
Target Start/End: Original strand, 14904816 - 14904973
Alignment:
| Q |
29 |
tgtactttccgttgccatggaaaagatcgttgttgaagttaccaacgtagatatccccattggattttgtcagggtgtcgtgaccatgacgggaattcat |
128 |
Q |
| |
|
|||| ||||| ||||||||||||||||| || ||||||||||||| ||||| |||||| ||||||||| | |||||||||||||||||||| |||| | |
|
|
| T |
14904816 |
tgtattttcctttgccatggaaaagatcattcttgaagttaccaatgtagacatccccgttggattttataagggtgtcgtgaccatgacgagaatcttt |
14904915 |
T |
 |
| Q |
129 |
ggagaattcaccctcaaaacttgttcttgatggatatatgatccgtcctttccctgtc |
186 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||| ||||| |||||||||||| |
|
|
| T |
14904916 |
aaagaattcaccctcaaaactttctcctgatggaaatatcatccgccctttccctgtc |
14904973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 29 - 190
Target Start/End: Original strand, 14905437 - 14905598
Alignment:
| Q |
29 |
tgtactttccgttgccatggaaaagatcgttgttgaagttaccaacgtagatatccccattggattttgtcagggtgtcgtgaccatgacgggaattcat |
128 |
Q |
| |
|
|||||||||| |||||||||||| | | | ||||||||||||| ||||| || ||| ||||||||||| |||||| | |||||||||||||||||| | |
|
|
| T |
14905437 |
tgtactttcccttgccatggaaagaaccactcttgaagttaccaatgtagagattcccgttggattttgtaagggtgccttgaccatgacgggaattcct |
14905536 |
T |
 |
| Q |
129 |
ggagaattcaccctcaaaacttgttcttgatggatatatgatccgtcctttccctgtccttt |
190 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||| ||||| |||||||| ||||||| |
|
|
| T |
14905537 |
aaagaattcaccctcaaaacttgctcctgatggatatatcatccgccctttcccagtccttt |
14905598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 29 - 188
Target Start/End: Original strand, 14905023 - 14905182
Alignment:
| Q |
29 |
tgtactttccgttgccatggaaaagatcgttgttgaagttaccaacgtagatatccccattggattttgtcagggtgtcgtgaccatgacgggaattcat |
128 |
Q |
| |
|
|||||||||| ||||||||||||||| | || | |||||||||| |||| |||||| |||||| |||| ||||||||||| ||||||| | ||||| |
|
|
| T |
14905023 |
tgtactttcccttgccatggaaaagaccattctcaaagttaccaatatagagatccccgttggatcttgtaagggtgtcgtgtccatgactgatgttcat |
14905122 |
T |
 |
| Q |
129 |
ggagaattcaccctcaaaacttgttcttgatggatatatgatccgtcctttccctgtcct |
188 |
Q |
| |
|
|||||| ||||||||||||||| | ||||||| | || || ||||||||||||||||| |
|
|
| T |
14905123 |
tgagaatccaccctcaaaacttgcttctgatggaaagatcattcgtcctttccctgtcct |
14905182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 32 - 118
Target Start/End: Original strand, 14905233 - 14905319
Alignment:
| Q |
32 |
actttccgttgccatggaaaagatcgttgttgaagttaccaacgtagatatccccattggattttgtcagggtgtcgtgaccatgac |
118 |
Q |
| |
|
||||||| |||||||||||||||| || | ||||||||||||||||| |||||||||||| | ||| | |||| |||||||||||| |
|
|
| T |
14905233 |
actttcccttgccatggaaaagattattctcgaagttaccaacgtagacatccccattggaatgtgtaaaggtgccgtgaccatgac |
14905319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 101 - 167
Target Start/End: Original strand, 14903953 - 14904017
Alignment:
| Q |
101 |
gggtgtcgtgaccatgacgggaattcatggagaattcaccctcaaaacttgttcttgatggatatat |
167 |
Q |
| |
|
||||||||||||| ||| ||||||||| ||| |||||||||||||||||||| | |||||||||| |
|
|
| T |
14903953 |
gggtgtcgtgaccttgaaaggaattcatagag--ttcaccctcaaaacttgttcctaatggatatat |
14904017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 32 - 89
Target Start/End: Original strand, 38454191 - 38454248
Alignment:
| Q |
32 |
actttccgttgccatggaaaagatcgttgttgaagttaccaacgtagatatccccatt |
89 |
Q |
| |
|
|||||||||||||||| ||||| || | ||||||||||||||||||| ||||||||| |
|
|
| T |
38454191 |
actttccgttgccatgaaaaagttcatccttgaagttaccaacgtagacatccccatt |
38454248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University