View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12078_low_11 (Length: 251)
Name: NF12078_low_11
Description: NF12078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12078_low_11 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 899067 - 898833
Alignment:
| Q |
1 |
attgatgaggaaattgctggtaacgataattatagaagtggaacaataagttcttgattataaaactcttggtatttgacaaaagctaaaagtgatttta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
899067 |
attgatgaggaaattgctggtaacgataattatagaagtggaacaataagttcttgattataaaactcttggtatttgacaaaagctaaaagtgatttta |
898968 |
T |
|
| Q |
101 |
tgataatgtcttgtcataatactttcattccacaaaagaaagtgcaataattttgataaggttacctaaatagctaccatcgacattaaaaatggtgcaa |
200 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
898967 |
tgataatgtcttgtcacaatactttcattccacaaaagaaagtgcaataattttgataaggttacctaaatagctaccatcgacattaaaaatggtgcaa |
898868 |
T |
|
| Q |
201 |
caacgattagatgagttccattaaacccatacatc |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
898867 |
caacgattagatgagttccattaaacccatacatc |
898833 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University