View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12078_low_12 (Length: 220)
Name: NF12078_low_12
Description: NF12078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12078_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 1 - 183
Target Start/End: Complemental strand, 15671954 - 15671769
Alignment:
| Q |
1 |
aaattcgattggaatcacttaacttaacctattattttccttgccttttagtgaaaacataacatctttaataaaaaagata---ataattaactatgag |
97 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
15671954 |
aaattcgattggaatcacttaactttacctattattttccttgccttttagtgaaaacataacatctttaataaaaaagatagtaataattaactatgag |
15671855 |
T |
 |
| Q |
98 |
gaataggaattttaaatgtaacatccctctctccgtgattccactatagtttaagcatccgttagagaattgtcttataataccta |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
15671854 |
gaataggaattttaaatgtaacatccctctcttcgtgattccactatagtttaagcatctgttagagaattgtcttataacaccta |
15671769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University