View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12078_low_5 (Length: 311)
Name: NF12078_low_5
Description: NF12078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12078_low_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 1 - 305
Target Start/End: Original strand, 42393428 - 42393732
Alignment:
| Q |
1 |
acatgcgtccgccccttcctatggtgatccctccatgattgcttgcctgcccgcggaaatctaatcaataaacgggttcagtgtgaagatatttgcattc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42393428 |
acatgcgtccgccccttcctatggtgatccctccatgattgcttgcctacccgcggaaatctaatcaataaacgggttcagtgtgaagatatttgtattc |
42393527 |
T |
 |
| Q |
101 |
tatgtgattctgaacctgaagactgcaagcatgtttttcttatctgcccgatagcaaagcaatgttggggaaatcttcgcatattatagcaagcaatact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42393528 |
tatgtgattctgaacctgaagactgcaagcatgtttttcttatctgcccgatagcaaagcaatgttggggaaatcttcgcatattatagcaagcaatact |
42393627 |
T |
 |
| Q |
201 |
ggaacatcccagtcctctgctgatgttttcttcaaaatcttgaaaaagatgctcgatgagggcagacgtctctttatgatgatgttttggagtctatgga |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
42393628 |
ggaacatcccagtcctctgctgatgttttcttcaaaatcttgaaaaagatgctcgatgaggacagacgtctctttatgatgatgttttggaggctatgga |
42393727 |
T |
 |
| Q |
301 |
aatgt |
305 |
Q |
| |
|
||||| |
|
|
| T |
42393728 |
aatgt |
42393732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University