View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12078_low_6 (Length: 293)
Name: NF12078_low_6
Description: NF12078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12078_low_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 1 - 252
Target Start/End: Original strand, 899174 - 899425
Alignment:
| Q |
1 |
agtagttagtggtcatttagtttcacttagaaatgagtgaatattgattatagaggtgtagaattgctttagagtaaatttattttgtctcaaaatttaa |
100 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
899174 |
agtagttagtgtacatttagtttcacttataaatgagtgaatattgattatagaggtgtagaattgctttagagtaaatttattttgtctcaaaatttaa |
899273 |
T |
 |
| Q |
101 |
ttctaatttgaacctacaatttggaacttttgattttagaatcaacttttacattaagatttattgtttaattagtcattttggttttacgtatttaaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
899274 |
ttctaatttgaacctacaatttggaacttttgattttagaatcaacttttacattaagatttattgtttaattagtcattttggttttacgtatttaaat |
899373 |
T |
 |
| Q |
201 |
aaatccctttagtttcaaaaattaaatgtacatcactctaattcaatactca |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
899374 |
aaatccctttagtttcaaaaattaaatgtacatcactctaattcaatactca |
899425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.0000000001; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 251 - 289
Target Start/End: Complemental strand, 4799336 - 4799298
Alignment:
| Q |
251 |
catcgtttgatgcaccaatcggtatctttcttctctctc |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
4799336 |
catcgtttgatgcaccaatcggtatctttcttttctctc |
4799298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 251 - 289
Target Start/End: Complemental strand, 4804316 - 4804278
Alignment:
| Q |
251 |
catcgtttgatgcaccaatcggtatctttcttctctctc |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
4804316 |
catcgtttgatgcaccaatcggtatctttcttttctctc |
4804278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 251 - 289
Target Start/End: Complemental strand, 4800493 - 4800455
Alignment:
| Q |
251 |
catcgtttgatgcaccaatcggtatctttcttctctctc |
289 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
4800493 |
catcgtttgatgcaccaatcgatatctttcttttctctc |
4800455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 251 - 289
Target Start/End: Original strand, 22332128 - 22332166
Alignment:
| Q |
251 |
catcgtttgatgcaccaatcggtatctttcttctctctc |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
22332128 |
catcgtttgatgcaccaatcggtatctttcttttctctc |
22332166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 251 - 289
Target Start/End: Complemental strand, 23834053 - 23834015
Alignment:
| Q |
251 |
catcgtttgatgcaccaatcggtatctttcttctctctc |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
23834053 |
catcgtttgatgcaccaatcggtatctttcttttctctc |
23834015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University