View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12078_low_9 (Length: 258)
Name: NF12078_low_9
Description: NF12078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12078_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 182; Significance: 2e-98; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 4186362 - 4186134
Alignment:
| Q |
1 |
gtcacagaggtaacttccggtgaagaaggtgttgaggcggttgtaggcggtgggagggtggaaagcaaggaatgcttcagtaacctcttggccggcaagg |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4186362 |
gtcacagaggtagcttccggtgaagaaggtgttgaggcggttgtaggcggtgggagggtggaaagcaaggaatgcttcagtaacctcttggccggcaagg |
4186263 |
T |
 |
| Q |
101 |
ctgagtagagggaattcgccaccgggatggtggttggcccattcagagacgtcgtatatctttccgtcaatagcgatccatagtcgccacgtttgttgtg |
200 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |||| ||||||||||||| |
|
|
| T |
4186262 |
ctgattagagggaattcgccaccgggatggtggttggcccatttagagacgtcgtatatcttgccgtcaatggcga-----------cacgtttgttgtg |
4186174 |
T |
 |
| Q |
201 |
tttttggagttcttgcagtgaaatgtaggttggttttccc |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4186173 |
tttttggagttcttgcagtgaaatgtaggttggttttccc |
4186134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 53 - 237
Target Start/End: Complemental strand, 4195342 - 4195157
Alignment:
| Q |
53 |
ggagggtggaaagcaaggaatgcttcagtaacctcttggccggcaaggctgagtagagggaattcgccaccgggatggtggttggcccattcagagacgt |
152 |
Q |
| |
|
|||||||||||||| |||||||| || || || ||||||||||| ||| |||| ||||| | ||||| |||||||||||||||||||||| || |||| |
|
|
| T |
4195342 |
ggagggtggaaagcgaggaatgcatcggtgacatcttggccggcgaggttgaggagaggaagctcgccgccgggatggtggttggcccattttgaaacgt |
4195243 |
T |
 |
| Q |
153 |
cgtatatctttccgtcaatagcgatccat-agtcgccacgtttgttgtgtttttggagttcttgcagtgaaatgtaggttggtttt |
237 |
Q |
| |
|
|||| ||||| |||||||| | ||||||| ||||| || ||||||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
4195242 |
cgtagatcttgccgtcaatggagatccatgcatcgccgcgagtgttgtgtttttgaagttcttgcaatgaaatgtaggttggtttt |
4195157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University