View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12079_low_2 (Length: 241)
Name: NF12079_low_2
Description: NF12079
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12079_low_2 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 29907836 - 29908058
Alignment:
| Q |
1 |
acttagctgtggcaaccatggaggcaccctgcttgtcaagaaggaatataaagcaatagtgtcctgaccgtggcattaatcttgcaacccttcaaagatg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| || ||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
29907836 |
acttagctgtggcaaccatggaggcaccctgcttgtcaataaggaatataaagcaatcgtttcctgacagtggcattaatcttgcaacccttcaaagatg |
29907935 |
T |
|
| Q |
101 |
aacaggcaaaaaggctttaaaagaaaagtaataatcattaaccaaattaaccaaaataataatcaaaggcaaacaaacagcaatacaaaccttctcatca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29907936 |
aacaggcaaaaaggctttaaaagaaaagcaataatcattaaccaaattaaccaaaataataatcaaaggcaaacaaacagcaatacaaaccttctcatca |
29908035 |
T |
|
| Q |
201 |
acaaacaccatctcaatcgaatt |
223 |
Q |
| |
|
||||||||||||||||| ||||| |
|
|
| T |
29908036 |
acaaacaccatctcaattgaatt |
29908058 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University