View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12080_high_28 (Length: 295)
Name: NF12080_high_28
Description: NF12080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12080_high_28 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 15 - 279
Target Start/End: Complemental strand, 34966827 - 34966563
Alignment:
| Q |
15 |
atgaatgaaaaagggaaactcaactcaaaaggaaaatttgttcagtgctttttcctttcctgaattcatttttctgtcgggagtaaacaaacaaaatcaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34966827 |
atgaatgaaaaagggaaactcaactcaaaaggaaaatttgttcagtgctttttcctttcctgaattcatttttctgtcgggagtaaacaaacaaaatcaa |
34966728 |
T |
 |
| Q |
115 |
atgcttccctggggaatgagaataaaccctttttgcgcaaattacaaacatttggacccagtttattcaaggggagaatataagaaatagaagattaaag |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34966727 |
atgcttccctggggaatgagaataaaccctttttgcgcaaattacaaacatttggacccagtttattcaaggggagaatataagaaatagaagatcaaag |
34966628 |
T |
 |
| Q |
215 |
aaaaatannnnnnnnattgtgattatttagaaagtgtgttgtaagttttaacaaattgacattag |
279 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34966627 |
aaaaataatttttttattgtgattatttagaaagtgtgttgtaagttttaacaaattgacattag |
34966563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University