View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12080_high_31 (Length: 294)
Name: NF12080_high_31
Description: NF12080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12080_high_31 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 269
Target Start/End: Complemental strand, 43090909 - 43090641
Alignment:
| Q |
1 |
tgattctagatgaaattgtacatagagaggtactttttttctttttctattttgatatnnnnnnnnntatatatattttgtttaatggtggctttttaat |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
43090909 |
tgattctagatggaattgtacatagagaggtactttttttctttttctattttgatataaaaaaatatatatatattttgtttaatggtggctttttaat |
43090810 |
T |
|
| Q |
101 |
ttgtttccacatgtctaatcacaattttgtgtttggctcctagcctttacagtcaataccaatgtcccaccagctactagaggcgcataattttatgtat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43090809 |
ttgtttccacatgtctaatcacaattttgtgtttggctcctagcctttacagtcaataccaatgtcccaccagctactagaggcgcataattttatgtat |
43090710 |
T |
|
| Q |
201 |
tgtttggtatggttgacatatttgtggagccggcatgttcaacaaatatgcatactatatgatatactc |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43090709 |
tgtttggtatggttgacatatttgtggagccggcatgttcaacaaatatgcatactatatgatatactc |
43090641 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University