View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12080_high_44 (Length: 229)
Name: NF12080_high_44
Description: NF12080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12080_high_44 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 7 - 229
Target Start/End: Original strand, 13772045 - 13772263
Alignment:
| Q |
7 |
aagatttgcaatgatgtcttcgaaaattgtcaagcaatttgtcatagagccacaacgttgttagctagctgggagaatgctcaaggttggaaagcatcgg |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
13772045 |
aagatttgcaatgatgtcttcgaaaattgtcaagcaatttgtcatagagccacaacgttgttagctagctgggagaatgctcaaggttggaaaacatcgg |
13772144 |
T |
 |
| Q |
107 |
caccaattcctcaatatggattttgagatagactcaaaaacggtcgtggataacatctacggaaagcagattgttgtatctgattttagtgttataatta |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
13772145 |
caccaattcctcaatatggattttgagatagactcataaacggtcgtggatgacatctacggaaagcagattgttgtatctaattttagtgttataat-- |
13772242 |
T |
 |
| Q |
207 |
gctagtaattgtgtacacctact |
229 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
13772243 |
--tagtaattgtgtacacctact |
13772263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 52 - 108
Target Start/End: Original strand, 6770715 - 6770771
Alignment:
| Q |
52 |
agagccacaacgttgttagctagctgggagaatgctcaaggttggaaagcatcggca |
108 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||||| || |||| || ||||| |
|
|
| T |
6770715 |
agagccacaacactgttagctagttgggagaatgctcaagatttgaaaacaacggca |
6770771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University