View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12080_high_45 (Length: 228)
Name: NF12080_high_45
Description: NF12080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12080_high_45 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 7 - 160
Target Start/End: Complemental strand, 43336529 - 43336376
Alignment:
| Q |
7 |
acacacaccctctctattttgtataagactccgaccttcctttaactacaccagtttccctcaattttgtaaaaatagagtcgggagtgatttaaacata |
106 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43336529 |
acacacaccctctctattttgtataagacaccgaccttcctttaactacaccagtttccctcaattttgtaaaaatagagtcgggagtgatttaaacata |
43336430 |
T |
 |
| Q |
107 |
cttgatggaagttaagttcaatttcttcaacaaataagggtcgtgtggttaggg |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43336429 |
cttgatggaagttaagttcaatttcttcaacaaataagggtcgtgtggttaggg |
43336376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 200 - 228
Target Start/End: Complemental strand, 43336338 - 43336310
Alignment:
| Q |
200 |
tatttaagcatacttcaagaaggcgatta |
228 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
43336338 |
tatttaagcatacttcaagaaggcgatta |
43336310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University