View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12080_low_44 (Length: 240)
Name: NF12080_low_44
Description: NF12080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12080_low_44 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 102; Significance: 9e-51; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 1 - 152
Target Start/End: Original strand, 22467927 - 22468084
Alignment:
| Q |
1 |
tttgctttgcattcatatgttatactattttctaccttcatccaaaatgcagcatataactatctgtttca---------tcttcctaattttctgtatg |
91 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
22467927 |
tttgctttgcattcatatgttatactattttctaccttcatccaaaatgcagcatataactatctgtttcatcttttccttcttactaattttctgtatg |
22468026 |
T |
 |
| Q |
92 |
cattaatttaattaggctcttcatttttaaaataaaaattattattttgttgaacctaaat |
152 |
Q |
| |
|
||| ||||||||||||||||||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
22468027 |
catgaatttaattaggctcttca-ttttaaaat--aaattattattttgttgaacctaaat |
22468084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University