View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12080_low_45 (Length: 240)
Name: NF12080_low_45
Description: NF12080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12080_low_45 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 10 - 166
Target Start/End: Complemental strand, 49986301 - 49986145
Alignment:
| Q |
10 |
cgttggatgattggatcgagattggatggtggcatggtgcagatctcaagcttggcatttaagagtaataaaatcaaaatatgatttctttttgcaccgt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49986301 |
cgttggatgattggatcgagattggatggtggcatggtgcagatctcaagcttggcatttaagagtaataaaatcaaaatatgatttctttttgcaccgt |
49986202 |
T |
|
| Q |
110 |
ccaatccctatccaaatgccactaatgtgtttattgcatgaatgcgtggactggaga |
166 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49986201 |
ccaatccctatccaaatgccactaatgtgtttattgcatgaatgcgtggactggaga |
49986145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 164 - 222
Target Start/End: Complemental strand, 49986096 - 49986038
Alignment:
| Q |
164 |
agaaagtgagggccaaggaaagtgaagatgtaacactagcatttgacaggagacaaaat |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
49986096 |
agaaagtgagggccaaggaaagtgaagatgtaacactagcatttgacagcagacaaaat |
49986038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University