View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12080_low_51 (Length: 228)
Name: NF12080_low_51
Description: NF12080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12080_low_51 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 20 - 218
Target Start/End: Complemental strand, 26351624 - 26351426
Alignment:
| Q |
20 |
tggctgagtattgaggagtatcaaccaccactaacaactatgtgctttttctgctaacttcaataaacaaacgtgttagaacaaaagatagttgactatt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
26351624 |
tggctgagtattgaggagtatcaaccaccactaacaactatgtgctttttctgctaacttcaataaacaaacgtgttagaacaaaagagagttgactatt |
26351525 |
T |
 |
| Q |
120 |
tgataaggttgtgtttgagctttagagatctgaggttgtggaaagaaaggattataaaaatgggtgtgaatgttaatgtgaggattctttgtgtctgtg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
26351524 |
tgataaggttgtgtttgagctttagagatctgaggttgtggaaagaaaggattataaaaatgggtgtgaatgttaatgtgaggattctttgtgtttgtg |
26351426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University