View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12081_low_12 (Length: 286)
Name: NF12081_low_12
Description: NF12081
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12081_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 4e-87; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 2 - 230
Target Start/End: Complemental strand, 48655452 - 48655227
Alignment:
| Q |
2 |
ttataatgtttttgtagttgttcaactataatttcgnnnnnnntatttagtacttaaaaaagttataattgttcaacttttatttcctaaaataatttat |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
48655452 |
ttataatgtttttgtagttgttcaactataatttcgaaaaaaatgtttagtacttaaaaaagttataattgttcaacttt-atttcctaaaataatttat |
48655354 |
T |
 |
| Q |
102 |
tttttaat-aagtattttctgcacacaactgcggagaataaactattgattcatatttcgaatagaatcataatgaatgattaaatttaaaatttaatac |
200 |
Q |
| |
|
|||||||| |||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
48655353 |
tttttaatcaagtat---ctgcacacaactgcggagaataaactattgattcagatttcgaatagaatcataatgaatgacaaaatttaaaatttaatac |
48655257 |
T |
 |
| Q |
201 |
tattgaatgttgaaaactcacatcctctct |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
48655256 |
tattgaatgttgaaaactcacatcctctct |
48655227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 226 - 278
Target Start/End: Complemental strand, 14717434 - 14717382
Alignment:
| Q |
226 |
tctctttttgctttctctcttgtgagcagtcactgaaactctaatttcttctc |
278 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||| |||||||| ||||||||| |
|
|
| T |
14717434 |
tctcttttccctttctctcttgtgagccgtcaccaaaactctagtttcttctc |
14717382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University