View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12081_low_15 (Length: 256)
Name: NF12081_low_15
Description: NF12081
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12081_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 48655519 - 48655756
Alignment:
| Q |
1 |
gacatttatccaacaaactatcaaatcattgaagattcactccaaaaacatatcaaattatttattactttatgcttctactaaaataactactacattn |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
48655519 |
gacatttatccaacaaattatcaaatcattgaagattcactccaaaaacatatcaaattatttattactttatgcttctaataaaataactactacatta |
48655618 |
T |
 |
| Q |
101 |
nnnnnnnctactacatgagctctccacctaataagcagagtactttctctttttggaattttcatacctaaatttattaacccctaggatagcatttggg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
48655619 |
aaaaaa-ctactacatgagctctccacctaataagcagagtactttctctttttggaattttcatacctaaatttattatcccctaggatagcacttggg |
48655717 |
T |
 |
| Q |
201 |
tgacattgtttccgctatgggtagtttatcatatcttct |
239 |
Q |
| |
|
||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
48655718 |
tgaaattgtttcccctatgggtagtttatcatatcttct |
48655756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University