View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12082_low_15 (Length: 207)
Name: NF12082_low_15
Description: NF12082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12082_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 153; Significance: 3e-81; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 15 - 175
Target Start/End: Original strand, 41102797 - 41102957
Alignment:
| Q |
15 |
cataggcaaccaaatatgcgaaggccactataattagctgatttgtcaaacaccagttcaaaaggggatctattttgcaatataggcgatggtgttccgt |
114 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
41102797 |
cataagcaaccaaatatgcgaaggccactataattagctgatttgtcaaacaccagttcaaaaggggatctattttgcaatataggcgacggtgttccgt |
41102896 |
T |
 |
| Q |
115 |
ttattaagaaagtgtcagttaagacagattcactctagatgcatttagaaggtgtttacgc |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41102897 |
ttattaagaaagtgtcagttaagacagattcactctagatgcatttagaaggtgtttacgc |
41102957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 57 - 147
Target Start/End: Original strand, 1216186 - 1216276
Alignment:
| Q |
57 |
ttgtcaaacaccagttcaaaaggggatctattttgcaatataggcgatggtgttccgtttattaagaaagtgtcagttaagacagattcac |
147 |
Q |
| |
|
|||||||||| |||| ||||| ||| |||||||||||||||||| | ||||||| |||||| |||||| |||||||| | ||||||| |
|
|
| T |
1216186 |
ttgtcaaacaacagtccaaaaaggggtctattttgcaatataggtaacggtgttctgtttataggaaaagtggcagttaaggccgattcac |
1216276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University