View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12083_high_2 (Length: 366)

Name: NF12083_high_2
Description: NF12083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12083_high_2
NF12083_high_2
[»] chr4 (3 HSPs)
chr4 (1-349)||(24751460-24751812)
chr4 (28-127)||(24766647-24766746)
chr4 (28-130)||(51500843-51500945)


Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 349
Target Start/End: Original strand, 24751460 - 24751812
Alignment:
1 gaaaattaagggatgcgagacattcatggatatttcccaaaatccccttccagttggaaatggtaatgctata----gagttgggtcaggttgaaaattg 96  Q
    ||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |    |||||| || |||||| ||||||    
24751460 gaaaattaaggtatgcgagacattcagggatatttcccaaaatccccttccagttggaaatggtaatgctagatagagagttgtgttaggttgcaaattg 24751559  T
97 acggggagatgtgtccgttcatgtatccacttttagactttagtggttttggtgtgttttgtagtggcagtggttgtctctgaccatgaggcaagggagt 196  Q
    | |||||||||||||||||||||||||||||||||||| |||||  |||||||||||||||||||||||||||||||| |||||| ||| || |||||||    
24751560 agggggagatgtgtccgttcatgtatccacttttagacattagttattttggtgtgttttgtagtggcagtggttgtcactgaccgtgaagctagggagt 24751659  T
197 atgatatcagcgatgtgatgtgtggttgggacgcagctgatgctgtactaattgtaggaacagttggtgtccttgactatgttctcacatgtttggttgt 296  Q
    |||||||| ||||||  ||||||||  |||  |||||||| || ||||||| |||| ||||||||||||||||||||||||||||||||||||||||||     
24751660 atgatatccgcgatgccatgtgtggccgggttgcagctgacgccgtactaactgtaagaacagttggtgtccttgactatgttctcacatgtttggttgc 24751759  T
297 tgcaatcaagttttgatgtagaaattgatgtttaagttgaaagttaagaataa 349  Q
    |||||||||||||||||||||||||||||||||||| ||||||||||||||||    
24751760 tgcaatcaagttttgatgtagaaattgatgtttaagctgaaagttaagaataa 24751812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 28 - 127
Target Start/End: Original strand, 24766647 - 24766746
Alignment:
28 ggatatttcccaaaatccccttccagttggaaatggtaatgctatagagttgggtcaggttgaaaattgacggggagatgtgtccgttcatgtatccact 127  Q
    ||||||||||| |||| |||||||| | ||| |||||||||||| | ||||| || |||||| ||||||| ||||||||||||||| |||||||||||||    
24766647 ggatatttcccgaaatacccttccaatcggagatggtaatgctagatagttgtgttaggttgcaaattgatggggagatgtgtccggtcatgtatccact 24766746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 28 - 130
Target Start/End: Complemental strand, 51500945 - 51500843
Alignment:
28 ggatatttcccaaaatccccttccagttggaaatggtaatgctatagagttgggtcaggttgaaaattgacggggagatgtgtccgttcatgtatccact 127  Q
    ||||||| ||| |||| |||||||||| ||| | |||||||||| ||||  | || |||||| ||||||| ||||||||||||||| ||||||||||| |    
51500945 ggatattccccgaaatgcccttccagtcggagacggtaatgctagagagccgtgttaggttgcaaattgatggggagatgtgtccggtcatgtatccatt 51500846  T
128 ttt 130  Q
    |||    
51500845 ttt 51500843  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University