View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12083_low_2 (Length: 366)
Name: NF12083_low_2
Description: NF12083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12083_low_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 349
Target Start/End: Original strand, 24751460 - 24751812
Alignment:
| Q |
1 |
gaaaattaagggatgcgagacattcatggatatttcccaaaatccccttccagttggaaatggtaatgctata----gagttgggtcaggttgaaaattg |
96 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| | |||||| || |||||| |||||| |
|
|
| T |
24751460 |
gaaaattaaggtatgcgagacattcagggatatttcccaaaatccccttccagttggaaatggtaatgctagatagagagttgtgttaggttgcaaattg |
24751559 |
T |
 |
| Q |
97 |
acggggagatgtgtccgttcatgtatccacttttagactttagtggttttggtgtgttttgtagtggcagtggttgtctctgaccatgaggcaagggagt |
196 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |||||| ||| || ||||||| |
|
|
| T |
24751560 |
agggggagatgtgtccgttcatgtatccacttttagacattagttattttggtgtgttttgtagtggcagtggttgtcactgaccgtgaagctagggagt |
24751659 |
T |
 |
| Q |
197 |
atgatatcagcgatgtgatgtgtggttgggacgcagctgatgctgtactaattgtaggaacagttggtgtccttgactatgttctcacatgtttggttgt |
296 |
Q |
| |
|
|||||||| |||||| |||||||| ||| |||||||| || ||||||| |||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24751660 |
atgatatccgcgatgccatgtgtggccgggttgcagctgacgccgtactaactgtaagaacagttggtgtccttgactatgttctcacatgtttggttgc |
24751759 |
T |
 |
| Q |
297 |
tgcaatcaagttttgatgtagaaattgatgtttaagttgaaagttaagaataa |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
24751760 |
tgcaatcaagttttgatgtagaaattgatgtttaagctgaaagttaagaataa |
24751812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 28 - 127
Target Start/End: Original strand, 24766647 - 24766746
Alignment:
| Q |
28 |
ggatatttcccaaaatccccttccagttggaaatggtaatgctatagagttgggtcaggttgaaaattgacggggagatgtgtccgttcatgtatccact |
127 |
Q |
| |
|
||||||||||| |||| |||||||| | ||| |||||||||||| | ||||| || |||||| ||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
24766647 |
ggatatttcccgaaatacccttccaatcggagatggtaatgctagatagttgtgttaggttgcaaattgatggggagatgtgtccggtcatgtatccact |
24766746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 28 - 130
Target Start/End: Complemental strand, 51500945 - 51500843
Alignment:
| Q |
28 |
ggatatttcccaaaatccccttccagttggaaatggtaatgctatagagttgggtcaggttgaaaattgacggggagatgtgtccgttcatgtatccact |
127 |
Q |
| |
|
||||||| ||| |||| |||||||||| ||| | |||||||||| |||| | || |||||| ||||||| ||||||||||||||| ||||||||||| | |
|
|
| T |
51500945 |
ggatattccccgaaatgcccttccagtcggagacggtaatgctagagagccgtgttaggttgcaaattgatggggagatgtgtccggtcatgtatccatt |
51500846 |
T |
 |
| Q |
128 |
ttt |
130 |
Q |
| |
|
||| |
|
|
| T |
51500845 |
ttt |
51500843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University