View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12084_high_16 (Length: 324)
Name: NF12084_high_16
Description: NF12084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12084_high_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 29 - 310
Target Start/End: Complemental strand, 34899975 - 34899696
Alignment:
| Q |
29 |
atctcaacttgaaagttgaaactaccaaactttacctatatgcatataaacacatctctctttagttcttctctcgctatttgatgtcaacaaaagctaa |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899975 |
atctcaacttgaaagttgaaactaccaaactttacctatatgcatataaacacatctctctttagttcttctctcgctatttgatgtcaacaaaagctaa |
34899876 |
T |
 |
| Q |
129 |
attgtgtcttcccctgcgtgtatgcaaccttatagtctcaaaattttccttccattctcaccaaacatgaaaggtatgtatcttccaactacaaaatttt |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899875 |
attgtgtcttcccctgcgtgtatgcaaccttatagtctcaaaattttccttccattctcaccaaacatgaaaggtatgtatcttccaactacaaaatttt |
34899776 |
T |
 |
| Q |
229 |
atgtgaatttgtgcagatgatatcactgacaatatgatgatgt-ccatctcattgcctatcccttattataacatttgcatat |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| || | ||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
34899775 |
atgtgaatttgtgcagatgatatcactgacaatatgataatttggtatctc-ttgcctat--cttattataacatttgcatat |
34899696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University