View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12085_low_2 (Length: 645)
Name: NF12085_low_2
Description: NF12085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12085_low_2 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 216; Significance: 1e-118; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 19 - 264
Target Start/End: Original strand, 5465289 - 5465531
Alignment:
| Q |
19 |
atgttgttattttcaatccacactttcatacattcagatcattggtggtggtgatgcatgacattgcggttgttcaatcaaatagttcacattcacgcgt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5465289 |
atgttgttattttcaatccacactttcatacattcagatcattggt---ggtgatgcatgacattgcggttgttcaatcaaatagttcacattcacgcgt |
5465385 |
T |
|
| Q |
119 |
tctgaacatttgcgacaactcattgatgacattgttgttgttcatcaagtcatcgatgttccgaatgcgtgatcacgtggacataatattcgtggtcaac |
218 |
Q |
| |
|
||||||||||| ||||||||||||| |||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5465386 |
tctgaacatttccgacaactcattgttgactttgctgttgttcatcaagtcatcgatgttccgaatgcgtgatcacgtggacataatattcgtggtcaac |
5465485 |
T |
|
| Q |
219 |
tgttaacttcattcctcccataaaaagaggcctgcctgcccctaac |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5465486 |
tgttaacttcattcctcccataaaaagaggcctgcctgcccctaac |
5465531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 125; E-Value: 5e-64
Query Start/End: Original strand, 472 - 628
Target Start/End: Original strand, 5465740 - 5465896
Alignment:
| Q |
472 |
cgtaataaaacactacccacaatcccaaaacccgtttcgacccgtaacccggttaatcacgccccggctattctctccccggctgattctcatctaaacc |
571 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||| |||| ||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
5465740 |
cgtaataaaacaccacccacaatcccaaaacccgtttcgacccgtaaccccgttacccacgccccggccattctctcaccggctgattctcatctaaacc |
5465839 |
T |
|
| Q |
572 |
gacctgacgataatgactcaaccccaactctcttttccaaacctgcgtcccatgatg |
628 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
5465840 |
gacctgacgataatgactcaactccaactctcttttccaaaccagcgtcccatgatg |
5465896 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 71; E-Value: 8e-32
Query Start/End: Original strand, 314 - 388
Target Start/End: Original strand, 5465582 - 5465656
Alignment:
| Q |
314 |
acatatgaatctatctaactaactctgtacttattcttcttttgttcacacaatacatagtattgcaaatgcatg |
388 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5465582 |
acatatgaatctatctaactaactctgtactaattcttcttttgttcacacaatacatagtattgcaaatgcatg |
5465656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University