View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12085_low_20 (Length: 237)
Name: NF12085_low_20
Description: NF12085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12085_low_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 40054070 - 40053845
Alignment:
| Q |
1 |
tggattcacaggtattgcctcattgtcttttatacttctcaacaaattgccgatcttgtattcttttgtggtcttacttgctcaccttccctaactaact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
40054070 |
tggattcacaggtattgcctcattgtcttttatacttctcaacaaattgccgatcttgtattctcttgtggtcttacttgctcaccttccctaactaact |
40053971 |
T |
 |
| Q |
101 |
atttg-ctctctttaaaactcaggtcgtgtctgtaacctcatttaatggaggcaatagtcatgacatgataccagactcagtggtcattggtgggacctt |
199 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40053970 |
atttggctctctttaaaactcaggtcgtgtctgtaacttcatttaatggaggcaatagtcatgacatgataccagactcagtggtcattggtgggacctt |
40053871 |
T |
 |
| Q |
200 |
cagagcgttttctaacaccagttttt |
225 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
40053870 |
cagagcgttttctaacaccagttttt |
40053845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University